igsf9ba

Ensembl ID:
ENSDARG00000033845
ZFIN ID:
ZDB-GENE-060503-729
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8DZ81]
Human Orthologue:
IGSF9B
Human Description:
immunoglobulin superfamily, member 9B [Source:HGNC Symbol;Acc:32326]
Mouse Orthologue:
Igsf9b
Mouse Description:
immunoglobulin superfamily, member 9B Gene [Source:MGI Symbol;Acc:MGI:2685354]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35860 Nonsense Mutation detected in F1 DNA During 2016
sa22617 Essential Splice Site Available for shipment Available now
sa35859 Nonsense Mutation detected in F1 DNA During 2016
sa35858 Nonsense Mutation detected in F1 DNA During 2016
sa18249 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092705 Nonsense 203 1360 5 21
ENSDART00000138895 Nonsense 182 1309 4 17
Genomic Location (Zv9):
Chromosome 15 (position 18071395)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19235209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGGTGAGTGACGGCAGTCTGACGGTACAGGCCATCACCCGGGAGGAC[C/T]GAGGGGCCTACAGCTGCCGTGCCCACAGTGACCAGGGGGAGGCACTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092705 Essential Splice Site 417 1360 9 21
ENSDART00000138895 Essential Splice Site 396 1309 8 17
Genomic Location (Zv9):
Chromosome 15 (position 18047467)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19211281
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCTAGGTACCATGGGACAGTCCCCTCCGGCCACTCTGGTGCTAAAGG[T/C]GAGTCAGTGCATCTTAACGAGATCATATCAGAAAGAAAGTTTGCGTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092705 Nonsense 590 1360 13 21
ENSDART00000138895 Nonsense 569 1309 12 17
Genomic Location (Zv9):
Chromosome 15 (position 18043374)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19207188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTCAGGGGTTGGAGCCAAAGACTGCCTATCAATTCAGTGTGCTGGCC[C/T]AGAACAAACTGGGCACCGGCCCCTTCAGTGAGGTAGTCACTGTGACTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092705 Nonsense 843 1360 18 21
ENSDART00000138895 Nonsense 822 1309 17 17
Genomic Location (Zv9):
Chromosome 15 (position 18040268)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19204082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAACCAAGAGAGCAATAACCAGTAAGAAGTACAGCGTGTCCAAGCAC[G/T]AGGCTGAGGTCACCACGCCCATCGAGCTGATCAGCCGTGGACCTGATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18249
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092705 Essential Splice Site 1330 1360 None 21
ENSDART00000138895   1309 1309 None 17
Genomic Location (Zv9):
Chromosome 15 (position 18038804)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19202618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGARAAGGACAGATGAGGAGATGCTCCCCTCAGAACCCTCTCCAGGG[T/C]AGGTGAACCGTACCATTGGAGGCTCCAAAATGACAAAGGAGACTGTTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link