FAT3 (1 of 4)

Ensembl ID:
ENSDARG00000033840
Description:
FAT tumor suppressor homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:23112]
Human Orthologue:
FAT3
Human Description:
FAT tumor suppressor homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:23112]
Mouse Orthologue:
Fat3
Mouse Description:
FAT tumor suppressor homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2444314]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14477 Nonsense Available for shipment Available now
sa18401 Nonsense Available for shipment Available now
sa9310 Nonsense Mutation detected in F1 DNA During 2014
sa6396 Nonsense Mutation detected in F1 DNA During 2014
sa22715 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8939 Nonsense Mutation detected in F1 DNA During 2014
sa22716 Nonsense Mutation detected in F1 DNA During 2014
sa22717 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8487 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 752 4550 5 34
Genomic Location:
Chromosome 15 (position 39321513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTGTGTTTCAGGTAAAAGCCCTTGATGGAGACACTGGGTTTAATGGA[C/T]AGCTTTTAYATRCCATTGCTGAYGGCAACACAGATAGTTGTTTTAGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 861 4550 5 34
Genomic Location:
Chromosome 15 (position 39321842)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTAGAGGCTACTGACAAAGATCAAGGTCTYAAWGGAGAGATCCAGTA[T/G]TCTCTGCTAACCAGCAYCTCCCAATTWGGCATTAACAGCTCCAGTGGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 2217 4550 14 34
Genomic Location:
Chromosome 15 (position 39418656)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATTTTGGGAATAAATGCCAGCAGCCCTGAAGGCCAGAGTGTCCTTTA[C/A]ACAATAAYACATGGTGACCCTGGAACCCTCTTCTCTATTGGATTTGACAM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 2561 4550 14 34
Genomic Location:
Chromosome 15 (position 39419686)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATAGYAGTGGGCAAATCACAACTCTTGAAAGACTGGACMGGGAAGAG[C/T]GAAGTGAGATGGTGCTGTCTGTTGCGGCCRTGGATGCAGGTGGTCGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Essential Splice Site 3844 4550 25 34
Genomic Location:
Chromosome 15 (position 39467294)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCCATATGCATGCCAGTGTCCACCAGGCAAACTGGGAGAGTGTGCAGG[T/C]ACAGTAACCACTCCTGACCATCGTGTTGAGCATTTTAATAAGTGATTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 3935 4550 27 34
Genomic Location:
Chromosome 15 (position 39471636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYGGCCGGTTAGTAAATGACGGGAACTGGCACCATGTGGTCCTGRAGCTG[C/T]GAGGAAACTACAGCAGCCTCTCTTTAGAYGATATGTATGTGGAGCGGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 4028 4550 27 34
Genomic Location:
Chromosome 15 (position 39471917)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGTCCCTATGCGGAAGTGGTGGGATTGACAGATCTCAAACTGGGATG[T/A]GTTCTGTATCCTGACGCATGTGTCGCTCAGCCCTGCCTCAACGGCGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Essential Splice Site 4104 4550 28 34
Genomic Location:
Chromosome 15 (position 39478142)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGAAACGCCTTCATCTGCAGCTGCAAGAGAGGATACACCGGTGCAACG[T/A]CAGTTCAACACTGTTTATACTTTCAAGTCACAAGATGTTTTAAACTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 4436 4550 34 34
Genomic Location:
Chromosome 15 (position 39513999)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCCCACTTATGAAACACCTGAAGTTGSCGTGGCCTTAGAGTCAGACTA[T/A]TACCTGGGCGGATTTGACATTGACAGTGACTACCCGCCTCCTCAGGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1wsp68w6