FAT3 (1 of 4)

Ensembl ID:
ENSDARG00000033840
Description:
FAT tumor suppressor homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:23112]
Human Orthologue:
FAT3
Human Description:
FAT tumor suppressor homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:23112]
Mouse Orthologue:
Fat3
Mouse Description:
FAT tumor suppressor homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2444314]

Alleles

There are 15 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42611 Nonsense Mutation detected in F1 DNA During 2018
sa44833 Nonsense Mutation detected in F1 DNA During 2018
sa14477 Nonsense Available for shipment Available now
sa18401 Nonsense Available for shipment Available now
sa42612 Nonsense Mutation detected in F1 DNA During 2018
sa42613 Nonsense Mutation detected in F1 DNA During 2018
sa35978 Nonsense Mutation detected in F1 DNA During 2018
sa9310 Nonsense Mutation detected in F1 DNA During 2018
sa6396 Nonsense Mutation detected in F1 DNA During 2018
sa42614 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22715 Essential Splice Site Available for shipment Available now
sa8939 Nonsense Mutation detected in F1 DNA During 2018
sa22716 Nonsense Available for shipment Available now
sa22717 Essential Splice Site Available for shipment Available now
sa8487 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 186 4550 4 34
Genomic Location (Zv9):
Chromosome 15 (position 39319781)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40836488
GRCz11 15 40793884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAGGTCACTGCCACGGATGCTGATATAGGATCAAATGGAGAGTTCTA[T/A]TACTTTTTCAAGGAGCGAATGGAGCTGTTCGCTGTGCACCCAACTAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 353 4550 5 34
Genomic Location (Zv9):
Chromosome 15 (position 39320316)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40837023
GRCz11 15 40794419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCTTGCAGGCTCGAGATCGTGGAACACCTCAGAAGTTATCTGCTGTG[C/T]AAATAGTACACTTACGATTATCAAGACCACCCCCTGTAGAAGTCACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 752 4550 5 34
Genomic Location (Zv9):
Chromosome 15 (position 39321513)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40838220
GRCz11 15 40795616
KASP Assay ID:
2260-8921.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTGTGTTTCAGGTAAAAGCCCTTGATGGAGACACTGGGTTTAATGGA[C/T]AGCTTTTAYATRCCATTGCTGAYGGCAACACAGATAGTTGTTTTAGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 861 4550 5 34
Genomic Location (Zv9):
Chromosome 15 (position 39321842)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40838549
GRCz11 15 40795945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTAGAGGCTACTGACAAAGATCAAGGTCTYAAWGGAGAGATCCAGTA[T/G]TCTCTGCTAACCAGCAYCTCCCAATTWGGCATTAACAGCTCCAGTGGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 1700 4550 14 34
Genomic Location (Zv9):
Chromosome 15 (position 39417105)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40933812
GRCz11 15 40891208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACTTCAGTCGTTACAGTGAATGCTTTAAGTCTTTCCACCCTTACCTA[T/A]GACATTCGCCATGGCAATGGTCATCGCACTTTCCGCATCAATCAGTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 2014 4550 14 34
Genomic Location (Zv9):
Chromosome 15 (position 39418047)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40934754
GRCz11 15 40892150
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGCTGTAGTGACAGCATTAGGCAACAAGTTGAATGAGCCCCTGCGTTA[T/A]ACTTTGCTCAATGCAGGTGGGAAATTTCGCATTAAGCCAACATCAGGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35978
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 2091 4550 14 34
Genomic Location (Zv9):
Chromosome 15 (position 39418276)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40934983
GRCz11 15 40892379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATGACAATGCTCCTGTTTTTGTTGGACTGCCATACTATGCTGCCGTG[C/T]AAGTGGAAGCAGAGCCGGGGACAGCAATATTTCGGGTGACAGCAGTAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 2217 4550 14 34
Genomic Location (Zv9):
Chromosome 15 (position 39418656)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40935363
GRCz11 15 40892759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATTTTGGGAATAAATGCCAGCAGCCCTGAAGGCCAGAGTGTCCTTTA[C/A]ACAATAAYACATGGTGACCCTGGAACCCTCTTCTCTATTGGATTTGACAM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 2561 4550 14 34
Genomic Location (Zv9):
Chromosome 15 (position 39419686)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40936393
GRCz11 15 40893789
KASP Assay ID:
554-5185.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATAGYAGTGGGCAAATCACAACTCTTGAAAGACTGGACMGGGAAGAG[C/T]GAAGTGAGATGGTGCTGTCTGTTGCGGCCRTGGATGCAGGTGGTCGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42614
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Essential Splice Site 3417 4550 20 34
Genomic Location (Zv9):
Chromosome 15 (position 39456707)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40973414
GRCz11 15 40930810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAATCACAGGACAGATCAAAGTCAACAAGCAGCTGGATCGAGAAACGG[T/C]GAGGACCACCATTCCCCCTAAATCCCACAAAGACTTTATCTGAAATGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Essential Splice Site 3844 4550 25 34
Genomic Location (Zv9):
Chromosome 15 (position 39467294)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40984001
GRCz11 15 40941397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCCATATGCATGCCAGTGTCCACCAGGCAAACTGGGAGAGTGTGCAGG[T/C]ACAGTAACCACTCCTGACCATCGTGTTGAGCATTTTAATAAGTGATTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 3935 4550 27 34
Genomic Location (Zv9):
Chromosome 15 (position 39471636)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40988343
GRCz11 15 40945739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYGGCCGGTTAGTAAATGACGGGAACTGGCACCATGTGGTCCTGRAGCTG[C/T]GAGGAAACTACAGCAGCCTCTCTTTAGAYGATATGTATGTGGAGCGGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 4028 4550 27 34
Genomic Location (Zv9):
Chromosome 15 (position 39471917)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40988624
GRCz11 15 40946020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGTCCCTATGCGGAAGTGGTGGGATTGACAGATCTCAAACTGGGATG[T/A]GTTCTGTATCCTGACGCATGTGTCGCTCAGCCCTGCCTCAACGGCGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Essential Splice Site 4104 4550 28 34
Genomic Location (Zv9):
Chromosome 15 (position 39478142)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40994849
GRCz11 15 40952245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGAAACGCCTTCATCTGCAGCTGCAAGAGAGGATACACCGGTGCAACG[T/A]CAGTTCAACACTGTTTATACTTTCAAGTCACAAGATGTTTTAAACTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042082 Nonsense 4436 4550 34 34
Genomic Location (Zv9):
Chromosome 15 (position 39513999)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41030706
GRCz11 15 40988102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCCCACTTATGAAACACCTGAAGTTGSCGTGGCCTTAGAGTCAGACTA[T/A]TACCTGGGCGGATTTGACATTGACAGTGACTACCCGCCTCCTCAGGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link