ampd1

Ensembl ID:
ENSDARG00000033832
ZFIN ID:
ZDB-GENE-040426-1906
Description:
AMP deaminase 1 [Source:RefSeq peptide;Acc:NP_957187]
Human Orthologue:
AMPD1
Human Description:
adenosine monophosphate deaminase 1 [Source:HGNC Symbol;Acc:468]
Mouse Orthologue:
Ampd1
Mouse Description:
adenosine monophosphate deaminase 1 Gene [Source:MGI Symbol;Acc:MGI:88015]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21209 Nonsense Mutation detected in F1 DNA During 2014
sa7609 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21209
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042755 Nonsense 294 717 7 15
Genomic Location:
Chromosome 8 (position 11610667)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCCTGCATGAACCAGAAGCATCTCCTCCGCTTCATCAAGAAGTCCTA[C/A]CGTGTGGATGCAGATCGGGTGGTGCATGTTTTGAAGGGCAAAGAAGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7609
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042755 Missense 645 717 14 15
Genomic Location:
Chromosome 8 (position 11623467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGAGCCACTGATGGAGGAGTACGCCATCGCAGCRCAGGTGTTCAAGC[T/G]CAGCACCTGTGACATGTGTGAGATCGCCAGAAACAGTGTCWTGCAGAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a3jhl6n8