hspbap1

Ensembl ID:
ENSDARG00000033771
ZFIN ID:
ZDB-GENE-040808-38
Description:
HSPB1-associated protein 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6AXL5]
Human Orthologue:
HSPBAP1
Human Description:
HSPB (heat shock 27kDa) associated protein 1 [Source:HGNC Symbol;Acc:16389]
Mouse Orthologue:
Hspbap1
Mouse Description:
Hspb associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1913917]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12596 Nonsense Available for shipment Available now
sa8349 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039913 Nonsense 72 449 3 8
Genomic Location:
Chromosome 9 (position 38416995)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYACTTTGTGTACACCAGCTCCTCTTTTTGAAACGGARTGTTCCTAYGTC[G/T]AAGCAACCATTAAAGAGTTTCTGTCCTGGACTGCTAATGAYGGKGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039913 Nonsense 213 449 5 8
Genomic Location:
Chromosome 9 (position 38406541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCATGTCAATGTGATTCGGCCTGACCTGAARAAGTTCCCAGCATATGGA[C/T]GAGCTCGGCTTYACACCRTCACACTGCAGCCTGGTCAGGTAGGCYTTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rm1pyzqs