ncaph2

Ensembl ID:
ENSDARG00000033757
ZFIN ID:
ZDB-GENE-041210-172
Description:
Condensin-2 complex subunit H2 [Source:UniProtKB/Swiss-Prot;Acc:Q5RH01]
Human Orthologue:
NCAPH2
Human Description:
non-SMC condensin II complex, subunit H2 [Source:HGNC Symbol;Acc:25071]
Mouse Orthologues:
AC171405.1, Ncaph2
Mouse Description:
non-SMC condensin II complex, subunit H2 Gene [Source:MGI Symbol;Acc:MGI:1289164]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40272 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040827 Nonsense 479 592 17 19
Genomic Location (Zv9):
Chromosome 4 (position 17517235)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18460075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGTTTCTGGTGAACTCTCAGAAGTATGCTCAAGAGACGGCGCTGTCT[C/T]GAAGAGTCAAGGACTGGGAGGACAGCATTAACCCTCATCTTGCTGCTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link