nt5c1bb

Ensembl ID:
ENSDARG00000033742
ZFIN ID:
ZDB-GENE-030131-7205
Description:
Novel protein similar to vertebrate cytosolic 5'-nucleotidase IB (NT5C1B) [Source:UniProtKB/TrEMBL;A
Human Orthologue:
NT5C1A
Human Description:
5'-nucleotidase, cytosolic IA [Source:HGNC Symbol;Acc:17819]
Mouse Orthologue:
Nt5c1a
Mouse Description:
5'-nucleotidase, cytosolic IA Gene [Source:MGI Symbol;Acc:MGI:2155700]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3053 Nonsense F2 line generated During 2017
sa36980 Nonsense Mutation detected in F1 DNA During 2017
sa23641 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3053
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039966 Nonsense 146 364 4 6
ENSDART00000148017 Nonsense 116 334 4 6
Genomic Location (Zv9):
Chromosome 20 (position 9462906)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9297175
KASP Assay ID:
554-2584.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATATGGTGYTAATAGAAAGATTCTCTTCTTCCAGATCTGACCATAGAG[C/T]GATTCTGCATGACTGGAGGTCAGAGTCCCATCGGCTACCTCAAAGCCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039966 Nonsense 214 364 5 6
ENSDART00000148017 Nonsense 184 334 5 6
Genomic Location (Zv9):
Chromosome 20 (position 9469040)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9303309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGAGACACAGCTGCGTGTCGCATTTGATGGAGACGCTGTGCTCTTCT[C/A]GGATGAGTCTGAGATCATAGTGAAACAGCACGGCCTGGACACCTTCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23641
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039966 Nonsense 246 364 6 6
ENSDART00000148017 Nonsense 216 334 6 6
Genomic Location (Zv9):
Chromosome 20 (position 9478576)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9312845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATAGATCTTCAGACTCAATGCATCCCTTTATATTTCTTCAGGGTCCTT[T/A]AAAATGCTTCCTGGAGGCTCTCGGGAAGCTCCAGAAGAAATTCTATGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link