ncf1

Ensembl ID:
ENSDARG00000033735
ZFIN ID:
ZDB-GENE-031006-6
Description:
neutrophil cytosol factor 1 [Source:RefSeq peptide;Acc:NP_001025242]
Human Orthologue:
NCF1
Human Description:
neutrophil cytosolic factor 1 [Source:HGNC Symbol;Acc:7660]
Mouse Orthologue:
Ncf1
Mouse Description:
neutrophil cytosolic factor 1 Gene [Source:MGI Symbol;Acc:MGI:97283]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33742 Nonsense Mutation detected in F1 DNA During 2017
sa31481 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050898 Nonsense 175 410 6 11
Genomic Location (Zv9):
Chromosome 5 (position 64502422)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60755082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTCGAGACCTACAGAGTGATCGCAGACTACAGCAAGAGCTCCAAGTA[T/A]GAGCTCACGCTGAAGATGGGAGACATGGTGGACATCGTGGAGAAAAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050898 Nonsense 272 410 9 11
Genomic Location (Zv9):
Chromosome 5 (position 64499477)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60752137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATAACAGATTGCCAAAAATTTAAAGGAAATGTCTTTTACAGGAAAGGC[G/T]AGGAAACCGGCTTCTATCCGTCCATGTTCCTGTGCAGGACGGGGGAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link