ntn1a

Ensembl ID:
ENSDARG00000033733
ZFIN ID:
ZDB-GENE-990415-169
Description:
netrin 1a [Source:RefSeq peptide;Acc:NP_571104]
Human Orthologue:
NTN1
Human Description:
netrin 1 [Source:HGNC Symbol;Acc:8029]
Mouse Orthologue:
Ntn1
Mouse Description:
netrin 1 Gene [Source:MGI Symbol;Acc:MGI:105088]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14131 Nonsense Available for shipment Available now
sa12269 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14131
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027806 Nonsense 286 603 1 7
Genomic Location (Zv9):
Chromosome 6 (position 18000182)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23454100
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCMTATTTTTACGCAGTTTCCGACCTGCAGRTTGGAGGCAGATGTAAGTG[T/A]AATGGACACGCATCACGGTGCGTCAAAGACCGGGATGGAAACCTAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027806 Nonsense 415 603 3 7
Genomic Location (Zv9):
Chromosome 6 (position 18096503)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23357779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTCGCAGCCTGTGATTGCCATYCTGTGGGGGCCGCGGGCAAAACCTG[T/A]AACCAAACCACAGGCCAATGCCCCTGTAAAGACGGTGTGACGGGTATCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link