ripk2

Ensembl ID:
ENSDARG00000033713
ZFIN IDs:
ZDB-GENE-030902-3, ZDB-GENE-030902-3
Description:
receptor-interacting serine/threonine-protein kinase 2 [Source:RefSeq peptide;Acc:NP_919392]
Human Orthologue:
RIPK2
Human Description:
receptor-interacting serine-threonine kinase 2 [Source:HGNC Symbol;Acc:10020]
Mouse Orthologue:
Ripk2
Mouse Description:
receptor (TNFRSF)-interacting serine-threonine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1891456]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39769 Missense, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39769
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043126 Missense 190 584 4 11
ENSDART00000109121 Nonsense 189 582 5 13
Genomic Location (Zv9):
Chromosome 2 (position 7280896)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7756724
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATTTTGGCTTGTCTAAATGGCGTCAGCTCTCGATCACCAAAGGCTCTG[G/A]CTCCAAACCTGCTGAAATGGGAGGCACAGTCATCTATATGCCACCTGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link