phf17

Ensembl ID:
ENSDARG00000033707
ZFIN ID:
ZDB-GENE-030131-5648
Description:
Protein Jade-1 [Source:UniProtKB/Swiss-Prot;Acc:Q803A0]
Human Orthologue:
PHF17
Human Description:
PHD finger protein 17 [Source:HGNC Symbol;Acc:30027]
Mouse Orthologue:
Phf17
Mouse Description:
PHD finger protein 17 Gene [Source:MGI Symbol;Acc:MGI:1925835]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10671 Nonsense Available for shipment Available now
sa10070 Essential Splice Site Available for shipment Available now
sa1499 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042060 Nonsense 134 829 5 11
ENSDART00000121706 Nonsense 134 829 4 10

The following transcripts of ENSDARG00000033707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 26674645)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26814564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTTGGGTACGTGGGTATTCAGACAYTGGCTGATGGCATGTGTCGCTA[T/A]GACCTGAATGAGGAGGACGTAGCTTGGCTGCAGATCACTAATGAAGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042060 Essential Splice Site 155 829 None 11
ENSDART00000121706 Essential Splice Site 155 829 None 10

The following transcripts of ENSDARG00000033707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 26674708)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26814627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGACGTAGCTTGGCTGCAGATCACTAATGAAGAGTTCAGTAAAATGGG[T/C]GAGCAAATACTGTCTGGAGTTTTCATTTTGCTCTTTATGCWAACAAATTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042060 Nonsense 438 829 9 11
ENSDART00000121706 Nonsense 438 829 8 10

The following transcripts of ENSDARG00000033707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 26684273)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26824192
KASP Assay ID:
554-1424.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAYGAGTTCTATCGCTTCGTCGCTGCTGATGAGGTTGCCGAACATCTG[C/T]AGCTTCCTCTTGAGATGGTGGACTTCTTGTTTCAATACTGGAAGTTGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link