gli1

Ensembl ID:
ENSDARG00000033680
ZFIN IDs:
ZDB-GENE-030321-1, ZDB-GENE-030321-1
Description:
zinc finger protein GLI1 [Source:RefSeq peptide;Acc:NP_840081]
Human Orthologue:
GLI1
Human Description:
GLI family zinc finger 1 [Source:HGNC Symbol;Acc:4317]
Mouse Orthologue:
Gli1
Mouse Description:
GLI-Kruppel family member GLI1 Gene [Source:MGI Symbol;Acc:MGI:95727]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8554 Nonsense Mutation detected in F1 DNA During 2017
sa38271 Nonsense Mutation detected in F1 DNA During 2017
sa31210 Nonsense Available for shipment Available now
sa32697 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049151 Nonsense 106 1404 4 13
ENSDART00000123101 Nonsense 106 1404 3 12
Genomic Location (Zv9):
Chromosome 1 (position 30733084)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 59444779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCAGGTATGAGCGGCGCCCCCTACTGTAACCAGAACATGATGACAT[C/A]SCATCATAATCTCCCTCATAACCAGCACACATCTGAACTCATGGCATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049151 Nonsense 344 1404 9 13
ENSDART00000123101 Nonsense 344 1404 8 12
Genomic Location (Zv9):
Chromosome 1 (position 30740275)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 59437588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCCACGGAGAGAAGAAGGAGTTCGTTTGCCACTGGAAGGACTGTTCC[C/T]GAGAGCAGCGTCCGTTTAAAGCGCAGTACATGCTGGTGGTGCACATGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31210
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049151 Nonsense 1182 1404 13 13
ENSDART00000123101 Nonsense 1182 1404 12 12
Genomic Location (Zv9):
Chromosome 1 (position 30743456)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 59434407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTTACCAAGGCTACCCAAATCAGAACTTGATGAGCCCACAGCAAAAT[C/T]GAGTTCCTGGATCTGTCAAAGAGCAAATGCAAAGCTCCTGCTATGGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049151 Nonsense 1273 1404 13 13
ENSDART00000123101 Nonsense 1273 1404 12 12
Genomic Location (Zv9):
Chromosome 1 (position 30743731)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 59434132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAGCAGCATTCAGAAAACTTCAACAACAACAACAACCCAATGTACTA[C/A]TCAGGCCAGATACACATGCACCACGACCTAGAGAAGACTCCAGAGGGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link