pi4k2a

Ensembl ID:
ENSDARG00000033666
ZFIN ID:
ZDB-GENE-040426-2675
Description:
Phosphatidylinositol 4-kinase type 2-alpha [Source:UniProtKB/Swiss-Prot;Acc:Q6PE18]
Human Orthologues:
PI4K2A, RP11-548K23.11
Human Description:
phosphatidylinositol 4-kinase type 2 alpha [Source:HGNC Symbol;Acc:30031]
Mouse Orthologue:
Pi4k2a
Mouse Description:
phosphatidylinositol 4-kinase type 2 alpha Gene [Source:MGI Symbol;Acc:MGI:1934031]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38300 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8708 Nonsense Mutation detected in F1 DNA During 2017
sa31238 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130675 Essential Splice Site 113 447 1 9
Genomic Location (Zv9):
Chromosome 1 (position 55277216)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54060155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTACCAGGGCTCCAGCGGCAGCTACTTCGTCAAAGATTCAGCAGGGG[T/A]AAGAGTTCATCAAACAGCAATCAGCAAGGCCTGAATTACACAACCCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130675 Nonsense 139 447 2 9
Genomic Location (Zv9):
Chromosome 1 (position 55287074)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54070013
KASP Assay ID:
2259-1218.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATGAAGAGCCGTACGGCCAGCTGAACCCCAAATGGACCAAATGGCTT[C/T]AGAAGCTGTGCTGTCCGTGCTGCTTCGGCCGYGACTGYCTGGTWCTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130675 Nonsense 170 447 2 9
Genomic Location (Zv9):
Chromosome 1 (position 55287167)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54070106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGAATCAGGGTTATCTATCAGAGGCCGGAGCCAGTTTAGTGGACCAG[A/T]AACTAGAACTCAACATTGTGCCGCGCACAAAGGTAAGAGAGCAACATCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link