scd

Ensembl ID:
ENSDARG00000033662
ZFIN ID:
ZDB-GENE-031106-3
Description:
stearoyl-CoA desaturase 1 [Source:RefSeq peptide;Acc:NP_942110]
Human Orthologue:
SCD
Human Description:
stearoyl-CoA desaturase (delta-9-desaturase) [Source:HGNC Symbol;Acc:10571]
Mouse Orthologues:
Scd1, Scd2, Scd3, Scd4
Mouse Descriptions:
stearoyl-Coenzyme A desaturase 1 Gene [Source:MGI Symbol;Acc:MGI:98239]
stearoyl-Coenzyme A desaturase 2 Gene [Source:MGI Symbol;Acc:MGI:98240]
stearoyl-coenzyme A desaturase 3 Gene [Source:MGI Symbol;Acc:MGI:1353437]
stearoyl-coenzyme A desaturase 4 Gene [Source:MGI Symbol;Acc:MGI:2670997]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17552 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050006 Nonsense 41 326 1 5
Genomic Location (Zv9):
Chromosome 12 (position 49689118)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48412491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTATATAAAGAGAAACCAGGCCCCAAGCCTCCTATGAAAATAGTGTGG[C/T]GAAATGTCATTCTGATGAGTCTTCTGCACATTGCTGCRGTGTATGGCCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link