rasgef1ba

Ensembl ID:
ENSDARG00000033614
ZFIN ID:
ZDB-GENE-030131-5783
Description:
Ras-GEF domain-containing family member 1B-A [Source:UniProtKB/Swiss-Prot;Acc:Q6DHR3]
Human Orthologue:
RASGEF1B
Human Description:
RasGEF domain family, member 1B [Source:HGNC Symbol;Acc:24881]
Mouse Orthologue:
Rasgef1b
Mouse Description:
RasGEF domain family, member 1B Gene [Source:MGI Symbol;Acc:MGI:2443755]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20496 Nonsense Mutation detected in F1 DNA During 2014
sa20495 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097880 Nonsense 44 494 3 15
ENSDART00000127123 Nonsense 23 473 2 14
ENSDART00000137801 Nonsense 64 514 3 15

The following transcripts of ENSDARG00000033614 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 41337828)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTCCAGTGATGTATGGATCCACCAATGGATACAACAAGAATCTCTAC[A/T]AGGCCAAGGAAGAGGACTATGAAGGCTTGTATTACCATGACAACAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097880 Essential Splice Site 264 494 7 15
ENSDART00000127123 Essential Splice Site 243 473 6 14
ENSDART00000137801 Essential Splice Site 284 514 7 15

The following transcripts of ENSDARG00000033614 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 41330832)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGTTTGTTCAGGCGTTTGTTCAGAAAGACCCTCTTGATAATGACAAG[G/A]TAACACTTTCTTCCTGTTTATGGGCAGTTAAAAATACACACGGCACAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3ml0lqpw