lrpap1

Ensembl ID:
ENSDARG00000033604
ZFIN ID:
ZDB-GENE-030131-5871
Description:
alpha-2-macroglobulin receptor-associated protein [Source:RefSeq peptide;Acc:NP_958463]
Human Orthologue:
LRPAP1
Human Description:
low density lipoprotein receptor-related protein associated protein 1 [Source:HGNC Symbol;Acc:6701]
Mouse Orthologue:
Lrpap1
Mouse Description:
low density lipoprotein receptor-related protein associated protein 1 Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31217 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043552 Nonsense 218 331 5 8
ENSDART00000145272 Nonsense 232 345 5 8
Genomic Location (Zv9):
Chromosome 1 (position 41517038)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40433279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTAAACCAGGGCTTTGAGCGTCTCCGCAAGATCACCCACGAGGGCTA[C/A]ACTGATGACAGCGGTGGGCAACATTGTTGATACTTAATCGGTGTTTTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link