ido1

Ensembl ID:
ENSDARG00000033594
ZFIN ID:
ZDB-GENE-080228-2
Description:
indoleamine 2,3-dioxygenase 2 [Source:RefSeq peptide;Acc:NP_001077323]
Human Orthologue:
IDO2
Human Description:
indoleamine 2,3-dioxygenase 2 [Source:HGNC Symbol;Acc:27269]
Mouse Orthologue:
Ido2
Mouse Description:
indoleamine 2,3-dioxygenase 2 Gene [Source:MGI Symbol;Acc:MGI:2142489]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12360 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056361 Nonsense 222 435 8 10
Genomic Location:
Chromosome 8 (position 52328278)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGARATAATCACAGGAGGACTTCAAAAGTHTGTCTTACTCTTTCAGAATA[T/A]GTAGATCCCTCCATATTCTACGGCGTTATAAGGATCTTTCTTTCTGGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zj347s41