LOC555957

Ensembl ID:
ENSDARG00000033589
Human Orthologue:
EPHB3
Human Description:
EPH receptor B3 [Source:HGNC Symbol;Acc:3394]
Mouse Orthologue:
Ephb3
Mouse Description:
Eph receptor B3 Gene [Source:MGI Symbol;Acc:MGI:104770]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3165 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3165
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050395 Essential Splice Site 557 974 7 15
Genomic Location:
Chromosome 22 (position 38856618)
KASP Assay ID:
554-2736.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACTGGTCTTCATCAYTGTTGTTGTGGTTATTGCCATTGTCTGCCTGAG[G/A]TAAACAACACTTTTGCTGCATTTATAACTACTGTATATGCAACTAGATGNT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/chz8ddr9