cyp17a1

Ensembl ID:
ENSDARG00000033566
ZFIN ID:
ZDB-GENE-040213-2
Description:
cytochrome P450, family 17, subfamily A, polypeptide 1 [Source:RefSeq peptide;Acc:NP_997971]
Human Orthologue:
CYP17A1
Human Description:
cytochrome P450, family 17, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2593]
Mouse Orthologue:
Cyp17a1
Mouse Description:
cytochrome P450, family 17, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88586]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7373 Missense Mutation detected in F1 DNA During 2014
sa22316 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043156 Missense 37 519 1 8
Genomic Location:
Chromosome 13 (position 28834118)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGGCAGCTCTGTATCTCAAACARAAGATGAATGGATTTGTGCCAGCA[G/C]GAAAYAGATSTCCTCCAAGTCTCCCTTCACTGCCCATCATCGGSAGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043156 Nonsense 469 519 8 8
Genomic Location:
Chromosome 13 (position 28825849)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCTCGGCGAGGCCCTGGCAAAGATGGAGCTCTTTCTCTTCCTGGCGT[G/A]GATTTTGCAAAGGTTTACTCTGGAGATGCCCACTGGCCAGCCTCTGCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/misz283h