cyp17a1

Ensembl ID:
ENSDARG00000033566
ZFIN ID:
ZDB-GENE-040213-2
Description:
cytochrome P450, family 17, subfamily A, polypeptide 1 [Source:RefSeq peptide;Acc:NP_997971]
Human Orthologue:
CYP17A1
Human Description:
cytochrome P450, family 17, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2593]
Mouse Orthologue:
Cyp17a1
Mouse Description:
cytochrome P450, family 17, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88586]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7373 Missense Mutation detected in F1 DNA During 2016
sa35505 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22316 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043156 Missense 37 519 1 8
Genomic Location:
Chromosome 13 (position 28834118)
KASP Assay ID:
554-4320.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGGCAGCTCTGTATCTCAAACARAAGATGAATGGATTTGTGCCAGCA[G/C]GAAAYAGATSTCCTCCAAGTCTCCCTTCACTGCCCATCATCGGSAGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043156 Essential Splice Site 264 519 4 8
Genomic Location:
Chromosome 13 (position 28830358)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTTCCATCAGAGATAAACTGCTTCAGAAGAAATATGAGGAACACAAG[G/A]TAAATGTGCAATTTCATATTACAAAAAAATGTAGCCTATGAAATGAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043156 Nonsense 469 519 8 8
Genomic Location:
Chromosome 13 (position 28825849)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCTCGGCGAGGCCCTGGCAAAGATGGAGCTCTTTCTCTTCCTGGCGT[G/A]GATTTTGCAAAGGTTTACTCTGGAGATGCCCACTGGCCAGCCTCTGCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link