pcdh11x

Ensembl ID:
ENSDARG00000033556
Human Orthologues:
PCDH11X, PCDH11Y
Human Descriptions:
protocadherin 11 X-linked [Source:HGNC Symbol;Acc:8656]
protocadherin 11 Y-linked [Source:HGNC Symbol;Acc:15813]
Mouse Orthologue:
Pcdh11x
Mouse Description:
protocadherin 11 X-linked Gene [Source:MGI Symbol;Acc:MGI:2442849]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31987 Nonsense Available for shipment Available now
sa18608 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113461 Nonsense 24 1036 1 3
Genomic Location (Zv9):
Chromosome 14 (position 28337258)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26990832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCATGTTCTGGTGGTTTTATTCACCTGCTTGTTCTTGATGTGCCGGGCT[C/T]AAGAAAAGGACTACACCGTAAAAGAGGAGCAGCCGGAGAATGTGCGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113461 Nonsense 656 1036 2 3
Genomic Location (Zv9):
Chromosome 14 (position 28330054)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 26983659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTTGTTGTCAAGGCTGTGGATGCAGGTCYAATGCAAACCACCTCATA[T/A]GCAAAGGTCACTATAAATGTTGTTGACGTGAACSACAATCGACCAGTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link