nkiras1

Ensembl ID:
ENSDARG00000033548
ZFIN ID:
ZDB-GENE-040718-215
Description:
NF-kappa-B inhibitor-interacting Ras-like protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6DGQ1]
Human Orthologue:
NKIRAS1
Human Description:
NFKB inhibitor interacting Ras-like 1 [Source:HGNC Symbol;Acc:17899]
Mouse Orthologue:
Nkiras1
Mouse Description:
NFKB inhibitor interacting Ras-like protein 1 Gene [Source:MGI Symbol;Acc:MGI:1916971]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43259 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043220 Nonsense 23 192 2 5
ENSDART00000143131 Nonsense 23 192 2 4
Genomic Location (Zv9):
Chromosome 19 (position 19372128)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17925263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTGTGGTTTGTGGTATGGCATCTGTGGGGAAAACAGCCATCCTGGAG[C/T]AATTACTATATGGGAGTCATACTGTAGGTATGTGTTCAGCACATTTACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link