LOC100002059

Ensembl ID:
ENSDARG00000033544
Human Orthologue:
ADAMTS15
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 15 [Source:HGNC Symbol;Acc:16305]
Mouse Orthologue:
Adamts15
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15 Gene

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42517 Nonsense Mutation detected in F1 DNA During 2016
sa13659 Nonsense Available for shipment Available now
sa22613 Nonsense Available for shipment Available now
sa42516 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032441 Nonsense 584 924 6 9
Genomic Location (Zv9):
Chromosome 15 (position 16627284)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17672247
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGGGAGGAGCAGTGTGAGATGTTTAATGGCTTTACACTGAACACTAAC[A/T]GACTGAGTCCATCTGTGGTTTGGGTCCCAAAGTACTCGGGAGTCTCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032441 Nonsense 603 924 6 9
Genomic Location (Zv9):
Chromosome 15 (position 16627227)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17672190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCATCTGTGGTTTGGGTCCCAAAGTACTCGGGAGTCTCTGTTAAAGAC[A/T]GATGTAAGCTCATCTGCAGAGCCAACGGCACCGGATACTTCTACGTCCTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032441 Nonsense 609 924 6 9
Genomic Location (Zv9):
Chromosome 15 (position 16627209)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17672172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCAAAGTACTCGGGAGTCTCTGTTAAAGACAGATGTAAGCTCATCTGC[A/T]GAGCCAACGGCACCGGATACTTCTACGTCCTTGCGCCAAAGGTAAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42516
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032441 Essential Splice Site 622 924 6 9
Genomic Location (Zv9):
Chromosome 15 (position 16627166)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17672129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGCAGAGCCAACGGCACCGGATACTTCTACGTCCTTGCGCCAAAGG[T/G]AAATAAACTGATTTATCTTCTTGAATATGGAAAAGTTGTTTGACATATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link