LOC100002059

Ensembl ID:
ENSDARG00000033544
Human Orthologue:
ADAMTS15
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 15 [Source:HGNC Symbol;Acc:16305]
Mouse Orthologue:
Adamts15
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15 Gene

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13659 Nonsense Available for shipment Available now
sa22613 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032441 Nonsense 603 924 6 9
Genomic Location:
Chromosome 15 (position 16627227)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCATCTGTGGTTTGGGTCCCAAAGTACTCGGGAGTCTCTGTTAAAGAC[A/T]GATGTAAGCTCATCTGCAGAGCCAACGGCACCGGATACTTCTACGTCCTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032441 Nonsense 609 924 6 9
Genomic Location:
Chromosome 15 (position 16627209)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCAAAGTACTCGGGAGTCTCTGTTAAAGACAGATGTAAGCTCATCTGC[A/T]GAGCCAACGGCACCGGATACTTCTACGTCCTTGCGCCAAAGGTAAATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uudpupnz