paics

Ensembl ID:
ENSDARG00000033539
ZFIN ID:
ZDB-GENE-030131-9762
Description:
multifunctional protein ADE2 [Source:RefSeq peptide;Acc:NP_955831]
Human Orthologue:
PAICS
Human Description:
phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase
Mouse Orthologue:
Paics
Mouse Description:
phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxami

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa892 Essential Splice Site F2 line generated During 2017
sa4900 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa892
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048164 Essential Splice Site 630 1050 7 15
ENSDART00000126716 Essential Splice Site 5 425 2 10
ENSDART00000132247 Essential Splice Site 5 425 2 10
ENSDART00000136475 Essential Splice Site 5 425 1 9
Genomic Location (Zv9):
Chromosome 20 (position 25655527)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25726830
KASP Assay ID:
554-0799.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTATTTTGCAGGAAAAACAAATCCCAGCAAGAATGTCTACTGCAACAG[G/A]TAAGTTAGAGTTTATTCTTCTGCTCGATTGTTTCTGTGTGCACCATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4900
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048164 Nonsense 765 1050 10 15
ENSDART00000126716 Nonsense 140 425 5 10
ENSDART00000132247 Nonsense 140 425 5 10
ENSDART00000136475 Nonsense 140 425 4 9
Genomic Location (Zv9):
Chromosome 20 (position 25653217)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25724520
KASP Assay ID:
554-3511.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TNATCTACTATTATGTTTTGCTCAGGATGATGCCAATAATGACCCTCAAT[G/A]GTCAGAAGAGCAGCTGTTGGCAGCTGGTTTTGACCTGGCTGGACTGACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link