efr3ba

Ensembl ID:
ENSDARG00000033516
ZFIN ID:
ZDB-GENE-030616-64
Description:
Novel protein similar to KIAA0953 [Source:UniProtKB/TrEMBL;Acc:Q7ZZB2]
Human Orthologue:
EFR3B
Human Description:
EFR3 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:29155]
Mouse Orthologue:
Efr3b
Mouse Description:
EFR3 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2444851]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16223 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040346 Nonsense 605 821 16 23
ENSDART00000135118 Nonsense 363 578 9 16

The following transcripts of ENSDARG00000033516 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 33448976)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTTCCTGTTTATTCCCGCTGTGCCATCCATGCTCTGTCTGCTGCATA[T/A]CTCAACCTCATCAGCCAACTGACCACTGTGCCCACCTTCTGCCAACACGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/of83h9io