nkapl

Ensembl ID:
ENSDARG00000033450
ZFIN ID:
ZDB-GENE-030131-8064
Description:
NF-kappa-B-activating protein [Source:RefSeq peptide;Acc:NP_001003414]
Human Orthologues:
NKAP, NKAPL
Human Descriptions:
NFKB activating protein [Source:HGNC Symbol;Acc:29873]
NFKB activating protein-like [Source:HGNC Symbol;Acc:21584]
Mouse Orthologues:
Nkap, Nkapl
Mouse Descriptions:
NFKB activating protein Gene [Source:MGI Symbol;Acc:MGI:1914300]
NFKB activating protein-like Gene [Source:MGI Symbol;Acc:MGI:1913957]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28335 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11850 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa28335
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001318 Essential Splice Site 185 368 None 8
ENSDART00000105688   None 349 None 9
ENSDART00000105800   None 136 None 4
ENSDART00000124629 Essential Splice Site 187 370 None 10
ENSDART00000126797 Essential Splice Site 147 322 None 9
Genomic Location (Zv9):
Chromosome 14 (position 34397805)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33082505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAACAGGAAGCAGTCAGAAGACAGCGAGTCAGAAAGTGATTCTGAAGG[T/C]TTGGGATTTTTTTTTCTGGAACAAATTTTATGAAAGACCATCTGAGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11850
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001318 Essential Splice Site 198 368 5 8
ENSDART00000105688   None 349 None 9
ENSDART00000105800   None 136 None 4
ENSDART00000124629   None 370 None 10
ENSDART00000126797   None 322 None 9
Genomic Location (Zv9):
Chromosome 14 (position 34395079)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33079779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTGCAGAAGARATGAAGAAGAAGAAAAAGAAGAARAAAAAYAAAAAG[T/A]AAGAATCTTGTTTTTAATCTGTGATRACTATATTGAATCRTYAAGGCTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study identifies a susceptibility locus for schizophrenia in Han Chinese at 11p11.2. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link