LOC556826

Ensembl ID:
ENSDARG00000033446
Human Orthologues:
TAP2, XXbac-BPG246D15.9
Human Descriptions:
transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) [Source:HGNC Symbol;Acc:44]
Truncated antigen peptide transporter 2 [Source:UniProtKB/TrEMBL;Acc:B6VNV2]
Mouse Orthologue:
Tap2
Mouse Description:
transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) Gene [Source:MGI Symbol;Acc:MGI:98484]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9721 Essential Splice Site Available for shipment Available now
sa13057 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039510 Essential Splice Site 262 728 3 11
Genomic Location (Zv9):
Chromosome 12 (position 28126481)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26464090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAATGTCATGAAGCAGGAGATAGACTTCTTTGATGAAATCAAACCAGG[T/C]AAACCAAAGAGGYCTAATTGTGTGACGTCTTTTTTGGAGGATTCTTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13057
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039510 Nonsense 556 728 8 11
Genomic Location (Zv9):
Chromosome 12 (position 28120643)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26458252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGAAATGTTCCTGGATRGAGAACCTCTKTACCRCTATCAACACCAGTA[T/G]TTGCATAAAAAGGCAAGAAACCGTACACAGGTGTTTANNGNNTTATCTAACTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lymphoma: Susceptibility loci associated with specific and shared subtypes of lymphoid malignancies. (View Study)
  • Nephropathy: Genome-wide association study identifies susceptibility loci for IgA nephropathy. (View Study)
  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link