mdm2

Ensembl ID:
ENSDARG00000033443
ZFIN ID:
ZDB-GENE-990415-153
Description:
E3 ubiquitin-protein ligase Mdm2 [Source:UniProtKB/Swiss-Prot;Acc:O42354]
Human Orthologue:
MDM2
Human Description:
Mdm2 p53 binding protein homolog (mouse) [Source:HGNC Symbol;Acc:6973]
Mouse Orthologue:
Mdm2
Mouse Description:
transformed mouse 3T3 cell double minute 2 Gene [Source:MGI Symbol;Acc:MGI:96952]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20278 Nonsense Mutation detected in F1 DNA During 2014
sa14240 Nonsense Available for shipment Available now
sa16808 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20278
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040435 Nonsense 255 445 9 14
ENSDART00000077854 Nonsense 255 475 10 11
ENSDART00000122675 Nonsense 255 475 9 10
ENSDART00000139543 None None 159 None 8

The following transcripts of ENSDARG00000033443 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 22068649)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAACAATTCTCAACTCAGCTTTTTTTTTTTTTGCTTATTCAGATATAT[G/T]AAGTCACAATCTTCGCAGAAGACGAAGACTCTTTTGATGAAGATACTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14240
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040435 Nonsense 320 445 10 14
ENSDART00000077854 Nonsense 320 475 11 11
ENSDART00000122675 Nonsense 320 475 10 10
ENSDART00000139543 None None 159 None 8

The following transcripts of ENSDARG00000033443 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 22070043)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGGCTTCCAGAAACACACTCCAACTGGGAAAACCTTTCAAGAAATACT[C/T]GAACCAAYCCCGAAGACACCAGCGTCACCACAAYTCCCAACACAACCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16808
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040435 Nonsense 416 445 14 14
ENSDART00000077854 Nonsense 446 475 11 11
ENSDART00000122675 Nonsense 446 475 10 10
ENSDART00000139543 None None 159 None 8

The following transcripts of ENSDARG00000033443 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 22070423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAACGGCTGCATTGTTCACGGAAGGACTGGGCACCTTATGGCGTGCTA[C/A]ACATGTGCCAAAAAATTAAAAAACCGGAACAAGTTGTGTCCGGTGTGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b3e5s941