rps6ka1

Ensembl ID:
ENSDARG00000033437
ZFIN ID:
ZDB-GENE-060929-516
Description:
ribosomal protein S6 kinase a, polypeptide 1 [Source:RefSeq peptide;Acc:NP_001071243]
Human Orthologue:
RPS6KA1
Human Description:
ribosomal protein S6 kinase, 90kDa, polypeptide 1 [Source:HGNC Symbol;Acc:10430]
Mouse Orthologue:
Rps6ka1
Mouse Description:
ribosomal protein S6 kinase polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:104558]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17002 Essential Splice Site Available for shipment Available now
sa16693 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044378 None None 759 None 21
ENSDART00000129273 Essential Splice Site 36 755 2 23
Genomic Location:
Chromosome 17 (position 26927708)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAATGGGCAGAGCACCACTGAGGATGGAGTTTCWTCATCTGTAARGG[T/C]AGGATTCAACTGACCACAAAAAAACACAAACCAACTTGTTTAGGATGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044378 Essential Splice Site 608 759 17 21
ENSDART00000129273 Essential Splice Site 604 755 19 23
Genomic Location:
Chromosome 17 (position 27006243)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCTCCTCATGACGCCTTGCTATACYGCCAATTTCGTAGCACCTGAGG[T/G]GAGCAGTTGTTCTTACAACAGAGCGGGKAATGCTGTATWGAGKGATTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cvdrf1ta