gpatch1

Ensembl ID:
ENSDARG00000033418
ZFIN ID:
ZDB-GENE-040914-65
Description:
Gpatch1 protein [Source:UniProtKB/TrEMBL;Acc:A0JMC1]
Human Orthologue:
GPATCH1
Human Description:
G patch domain containing 1 [Source:HGNC Symbol;Acc:24658]
Mouse Orthologue:
Gpatch1
Mouse Description:
G patch domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914721]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40954 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40955 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21018 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009386 Essential Splice Site 29 980 None 19
ENSDART00000128541 Essential Splice Site 24 975 None 19

The following transcripts of ENSDARG00000033418 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 39657549)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37994189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAAGATTTTGTGACTTACGGGACTCCCTTAGAACCTCTGGAAGAAGG[T/C]ATTGTATTTGTAAACTTACTCTGTTTTGTTGTTCTTCTCAACATATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009386 Essential Splice Site 74 980 3 19
ENSDART00000128541 Essential Splice Site 69 975 3 19

The following transcripts of ENSDARG00000033418 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 39657906)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37994546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTGTTAACCGAGTCTTGTATTAATTTAACTAATCTACTCTGTTCTTT[A/G]GGCTGGACGCCGTCAACATTTGTATCATCTCGACAACAAAAGTCCGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21018
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009386 Nonsense 377 980 10 19
ENSDART00000128541 Nonsense 372 975 10 19

The following transcripts of ENSDARG00000033418 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 39661293)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 37997933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTCTGTATTCTAGGTCTATCCTCCCCCTGATTTGCCTCGTGATTTT[C/T]GACCTGTACATTACTTCCGTCCTGTGATTGATCCATCCACCGTCAGCCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link