si:dkey-183c16.7

Ensembl ID:
ENSDARG00000033413
ZFIN ID:
ZDB-GENE-041210-254
Description:
Si:dkey-183c16.7 protein [Source:UniProtKB/TrEMBL;Acc:A8WG99]
Human Orthologues:
ACOT1, ACOT2, ACOT4, ACOT6, BAAT
Human Descriptions:
acyl-CoA thioesterase 1 [Source:HGNC Symbol;Acc:33128]
acyl-CoA thioesterase 2 [Source:HGNC Symbol;Acc:18431]
acyl-CoA thioesterase 4 [Source:HGNC Symbol;Acc:19748]
acyl-CoA thioesterase 6 [Source:HGNC Symbol;Acc:33159]
bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase) [Source:HGNC Symbol;Acc:9
Mouse Orthologues:
Acnat1, Acnat2, Acot1, Acot2, Acot3, Acot4, Acot5, Acot6, Baat
Mouse Descriptions:
acyl-CoA thioesterase 1 Gene [Source:MGI Symbol;Acc:MGI:1349396]
acyl-CoA thioesterase 2 Gene [Source:MGI Symbol;Acc:MGI:2159605]
acyl-CoA thioesterase 3 Gene [Source:MGI Symbol;Acc:MGI:2159619]
acyl-CoA thioesterase 4 Gene [Source:MGI Symbol;Acc:MGI:2159621]
acyl-CoA thioesterase 5 Gene [Source:MGI Symbol;Acc:MGI:2384969]
acyl-CoA thioesterase 6 Gene [Source:MGI Symbol;Acc:MGI:1921287]
acyl-coenzyme A amino acid N-acyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2140197]
acyl-coenzyme A amino acid N-acyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2444345]
bile acid-Coenzyme A: amino acid N-acyltransferase Gene [Source:MGI Symbol;Acc:MGI:106642]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44591 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33473 Nonsense Mutation detected in F1 DNA During 2017
sa26305 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40305 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047113 Essential Splice Site 6 438 None 11
ENSDART00000066944 Essential Splice Site 6 289 None 8
ENSDART00000132864   None 437 None 10
ENSDART00000139053 Essential Splice Site 40 472 None 12
Genomic Location (Zv9):
Chromosome 4 (position 24779492)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAAGAAAGAAACGTCTATTATCGGACTACCATGTTGGCACCTGTTAGG[T/C]AACGTACATATATTTCTTGTCATCAACAAAGGTTTTAACAAAATACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33473
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047113 Nonsense 101 438 3 11
ENSDART00000066944 Nonsense 101 289 4 8
ENSDART00000132864 Nonsense 100 437 2 10
ENSDART00000139053 Nonsense 135 472 4 12
Genomic Location (Zv9):
Chromosome 4 (position 24781824)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25705493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGGCACAGAGCAGATGGGTTTGCTGTGGAGCCTGAGGCCTGTACCA[G/T]GAAGTCGATCAGCTCTCAGGTAATGAATGATAGTGTACTAAGTTTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047113 Essential Splice Site 171 438 4 11
ENSDART00000066944 Essential Splice Site 171 289 5 8
ENSDART00000132864 Essential Splice Site 170 437 3 10
ENSDART00000139053 Essential Splice Site 205 472 5 12
Genomic Location (Zv9):
Chromosome 4 (position 24782164)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25705833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAACATAAGAGAGAATGGAGTTCGAGGAACTTTATTTCTACCCCCAGG[T/C]ACACACACACAGGAGAGGTGGTACACTTGTGGTAATACAAGAAAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047113 Nonsense 329 438 9 11
ENSDART00000066944   None 289 None 8
ENSDART00000132864 Nonsense 328 437 8 10
ENSDART00000139053 Nonsense 363 472 10 12
Genomic Location (Zv9):
Chromosome 4 (position 24785973)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25709642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGCTCTTTATAAATATTACATCTATTTTTAACGCAGGTTGGGAGAATA[A/T]AGTGTCCTGTTATGTTGGTGAATGGTGGTGATGATCAGAACTGGGCTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link