atoh1b

Ensembl ID:
ENSDARG00000033400
ZFIN ID:
ZDB-GENE-041201-1
Description:
atonal homolog 1b [Source:RefSeq peptide;Acc:NP_001122151]
Human Orthologue:
ATOH7
Human Description:
atonal homolog 7 (Drosophila) [Source:HGNC Symbol;Acc:13907]
Mouse Orthologue:
Atoh7
Mouse Description:
atonal homolog 7 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1355553]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5874 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045677 Nonsense 92 206 1 1
Genomic Location:
Chromosome 14 (position 51971769)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGATCTAAAGCTCGTYCTGGGAGTAAAGCATCTGTCAGTGGCCCTCAG[A/T]GACACAGGCGCGTKGCCGCAAATGCGCGTGAACGGCGGAGAATGCACGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rfkqq4nx