chchd4

Ensembl ID:
ENSDARG00000033376
ZFIN ID:
ZDB-GENE-040801-46
Description:
Mitochondrial intermembrane space import and assembly protein 40 [Source:UniProtKB/Swiss-Prot;Acc:Q6
Human Orthologue:
CHCHD4
Human Description:
coiled-coil-helix-coiled-coil-helix domain containing 4 [Source:HGNC Symbol;Acc:26467]
Mouse Orthologues:
AU015836, Chchd4
Mouse Descriptions:
coiled-coil-helix-coiled-coil-helix domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1919420]
expressed sequence AU015836 Gene [Source:MGI Symbol;Acc:MGI:2147954]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35133 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039847 Nonsense 66 146 3 3
ENSDART00000135725   None 44 None 3
Genomic Location (Zv9):
Chromosome 11 (position 35896976)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34518285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACTGGAACTGCCCGTGTTTGGGCGGCATGGCCAGTGGCCCTTGTGGA[C/T]AGCAGTTCAAGGATGCGTTTTCATGTTTCCACTATAGCAAAGAGGAGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link