rrm2b

Ensembl ID:
ENSDARG00000033367
ZFIN ID:
ZDB-GENE-030616-614
Description:
ribonucleoside-diphosphate reductase subunit M2 B [Source:RefSeq peptide;Acc:NP_001007164]
Human Orthologue:
RRM2B
Human Description:
ribonucleotide reductase M2 B (TP53 inducible) [Source:HGNC Symbol;Acc:17296]
Mouse Orthologue:
Rrm2b
Mouse Description:
ribonucleotide reductase M2 B (TP53 inducible) Gene [Source:MGI Symbol;Acc:MGI:2155865]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17865 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050750 Essential Splice Site 261 349 7 10
ENSDART00000141404 Essential Splice Site 261 349 7 9
Genomic Location:
Chromosome 19 (position 34294195)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTGACCGAGTGAATGACATTATCGCTAAAGCTGTGAGCATTGAACAG[G/T]TTGGTACATTTTCCAGTACTCTAATAATATTATTTCAAGCCCAACTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3ogglzmm