asl

Ensembl ID:
ENSDARG00000033361
ZFIN ID:
ZDB-GENE-040426-1152
Description:
argininosuccinate lyase [Source:RefSeq peptide;Acc:NP_956745]
Human Orthologues:
AC068533.7, ASL
Human Description:
argininosuccinate lyase [Source:HGNC Symbol;Acc:746]
Mouse Orthologue:
Asl
Mouse Description:
argininosuccinate lyase Gene [Source:MGI Symbol;Acc:MGI:88084]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19263 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7965 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13022 Essential Splice Site Available for shipment Available now
sa12812 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040190 Essential Splice Site 5 465 None 16
ENSDART00000132317 Essential Splice Site 5 240 None 10
ENSDART00000040190 Essential Splice Site 5 465 None 16
ENSDART00000132317 Essential Splice Site 5 240 None 10
Genomic Location:
Chromosome 21 (position 30016422)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCACGTAGGTCGCTACTCTAGAGACTGTTACAATGGCAAGTTCAGAGG[T/G]AAATATAGCTATTTAATTTCTGATTTTGCATGTGTTTCATAGTTACAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040190 Essential Splice Site 5 465 None 16
ENSDART00000132317 Essential Splice Site 5 240 None 10
ENSDART00000040190 Essential Splice Site 5 465 None 16
ENSDART00000132317 Essential Splice Site 5 240 None 10
Genomic Location:
Chromosome 21 (position 30016422)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCACGTAGGTCGCTACTCTAGAGACTGTTACAATGGCAAGTTCAGAGG[T/G]AAATATAGCTATTTAATTTCTGATTTTGCAYGTGTTTCATAGTTACAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13022
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040190 Essential Splice Site 117 465 4 16
ENSDART00000132317 Essential Splice Site 117 240 5 10
ENSDART00000040190 Essential Splice Site 117 465 4 16
ENSDART00000132317 Essential Splice Site 117 240 5 10
Genomic Location:
Chromosome 21 (position 30020980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGATGCTGCTGGAAAGCTTCATACTGGCAGGAGCAGAAATGATCAGG[T/G]TCCTCCAATTGTAATTTCAGTTTTGCTGTTATWTCGCATGACAYTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12812
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040190 Essential Splice Site 117 465 4 16
ENSDART00000132317 Essential Splice Site 117 240 5 10
ENSDART00000040190 Essential Splice Site 117 465 4 16
ENSDART00000132317 Essential Splice Site 117 240 5 10
Genomic Location:
Chromosome 21 (position 30020980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGATGCTGCTGGAAAGCTTCATACTGGCAGGAGCAGAAATGATCAGG[T/G]TCCTCCAATTGTAATTTCAGTTTTGCTGTTATWTCGCATGACAYTTAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/45l84mye