asl

Ensembl ID:
ENSDARG00000033361
ZFIN ID:
ZDB-GENE-040426-1152
Description:
argininosuccinate lyase [Source:RefSeq peptide;Acc:NP_956745]
Human Orthologues:
AC068533.7, ASL
Human Description:
argininosuccinate lyase [Source:HGNC Symbol;Acc:746]
Mouse Orthologue:
Asl
Mouse Description:
argininosuccinate lyase Gene [Source:MGI Symbol;Acc:MGI:88084]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13022 Essential Splice Site Available for shipment Available now
sa12812 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13022
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040190 Essential Splice Site 117 465 4 16
ENSDART00000132317 Essential Splice Site 117 240 5 10
ENSDART00000040190 Essential Splice Site 117 465 4 16
ENSDART00000132317 Essential Splice Site 117 240 5 10
Genomic Location (Zv9):
Chromosome 21 (position 30020980)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31221231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGATGCTGCTGGAAAGCTTCATACTGGCAGGAGCAGAAATGATCAGG[T/G]TCCTCCAATTGTAATTTCAGTTTTGCTGTTATWTCGCATGACAYTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12812
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040190 Essential Splice Site 117 465 4 16
ENSDART00000132317 Essential Splice Site 117 240 5 10
ENSDART00000040190 Essential Splice Site 117 465 4 16
ENSDART00000132317 Essential Splice Site 117 240 5 10
Genomic Location (Zv9):
Chromosome 21 (position 30020980)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31221231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGATGCTGCTGGAAAGCTTCATACTGGCAGGAGCAGAAATGATCAGG[T/G]TCCTCCAATTGTAATTTCAGTTTTGCTGTTATWTCGCATGACAYTTAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link