unc5b

Ensembl ID:
ENSDARG00000033327
ZFIN ID:
ZDB-GENE-041213-1
Description:
unc-5 homolog B [Source:RefSeq peptide;Acc:NP_001104619]
Human Orthologue:
UNC5B
Human Description:
unc-5 homolog B (C. elegans) [Source:HGNC Symbol;Acc:12568]
Mouse Orthologue:
Unc5b
Mouse Description:
unc-5 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:894703]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9232 Nonsense Mutation detected in F1 DNA During 2014
sa1 Nonsense Available for shipment Available now
sa13358 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045951 Nonsense 94 911 2 16
ENSDART00000109546 Nonsense 123 940 3 17
Genomic Location:
Chromosome 13 (position 29419602)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTAGTGAGAGAAGTAGATATCTCTRTCTCCCGGACGCAGGTAGAGGAGT[T/A]GTTTGGGCTGGARGATTATTGGTGCCAGTGTGTTGCCWGGAGCTCGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045951 Nonsense 232 911 5 16
ENSDART00000109546 Nonsense 261 940 6 17
Genomic Location:
Chromosome 13 (position 29424359)
KASP Assay ID:
554-0142.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTATTAGTAAGTGGAGGCTGGTCATCCTGGACAGAGTGGTCAGAATG[T/A]AATGCTCAGTGTGGGCGGGGCTGGCAGAGACGGACACGCAGCTGCACCAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045951 Nonsense 627 911 12 16
ENSDART00000109546 Nonsense 656 940 13 17
Genomic Location:
Chromosome 13 (position 29440311)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTAGGAGGTGCTGACTGTGGGAGAGGAGAGTCTRTCGTCACCCTGTTA[T/A]CTGCAGGTGGAGGAGCAGAGTTGTCATATCCTSATGGAGCAGCTGGGCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xeg7lr34