sar1a

Ensembl ID:
ENSDARG00000033320
ZFIN ID:
ZDB-GENE-050417-437
Description:
GTP-binding protein SAR1a [Source:RefSeq peptide;Acc:NP_001017882]
Human Orthologue:
SAR1A
Human Description:
SAR1 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:10534]
Mouse Orthologue:
Sar1a
Mouse Description:
SAR1 gene homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:98230]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42219 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041515 Nonsense 184 198 7 7
ENSDART00000143093 Nonsense 184 198 7 7
Genomic Location (Zv9):
Chromosome 13 (position 30369522)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30015470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCAACCTAAGGCCGATGGAAGTCTTTATGTGCAGTGTGTTGAAAAGA[C/T]AAGGATATGGTGAAGGATTTAGATGGCTTTCTCAGTATATTGATTAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link