osbpl3a

Ensembl ID:
ENSDARG00000033251
ZFIN ID:
ZDB-GENE-040912-77
Description:
oxysterol binding protein-like 3a [Source:RefSeq peptide;Acc:NP_001004646]
Human Orthologue:
OSBPL3
Human Description:
oxysterol binding protein-like 3 [Source:HGNC Symbol;Acc:16370]
Mouse Orthologue:
Osbpl3
Mouse Description:
oxysterol binding protein-like 3 Gene [Source:MGI Symbol;Acc:MGI:1918970]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17602 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043530 Nonsense 59 742 5 22
ENSDART00000125030 Nonsense 127 859 4 28
ENSDART00000142841 Nonsense 130 813 5 22
Genomic Location:
Chromosome 19 (position 20493119)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAAGAAAAAGTCCATGTGCATCGACCTGGACACAGAGGACAGTATCTA[T/A]CACCTCAAGGTATTGGCATATACACAAAAYAACTGTTCTTATTTTGAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/43pdtk18