osbpl3a

Ensembl ID:
ENSDARG00000033251
ZFIN ID:
ZDB-GENE-040912-77
Description:
oxysterol binding protein-like 3a [Source:RefSeq peptide;Acc:NP_001004646]
Human Orthologue:
OSBPL3
Human Description:
oxysterol binding protein-like 3 [Source:HGNC Symbol;Acc:16370]
Mouse Orthologue:
Osbpl3
Mouse Description:
oxysterol binding protein-like 3 Gene [Source:MGI Symbol;Acc:MGI:1918970]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17602 Nonsense Available for shipment Available now
sa44912 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa36821 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043530 Nonsense 59 742 5 22
ENSDART00000125030 Nonsense 127 859 4 28
ENSDART00000142841 Nonsense 130 813 5 22
Genomic Location (Zv9):
Chromosome 19 (position 20493119)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20426499
KASP Assay ID:
2261-3203.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAAGAAAAAGTCCATGTGCATCGACCTGGACACAGAGGACAGTATCTA[T/A]CACCTCAAGGTATTGGCATATACACAAAAYAACTGTTCTTATTTTGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043530 Splice Site, Nonsense 105 742 6 22
ENSDART00000125030   None 859 None 28
ENSDART00000142841 Splice Site, Nonsense 176 813 6 22
Genomic Location (Zv9):
Chromosome 19 (position 20493337)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGGAGCCTCCCGAGAGACAGCTGCAATCTGACCCCGCCTCCAGCAGA[C/T]AAGTACTCACTCTGTTTATACAGTAATCAGTCACAGTGGAATATAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043530 Essential Splice Site 279 742 12 22
ENSDART00000125030 Essential Splice Site 386 859 18 28
ENSDART00000142841 Essential Splice Site 350 813 12 22
Genomic Location (Zv9):
Chromosome 19 (position 20501162)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 20434542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCGTTTGCTGTTATCAACAAAGCTCATTTTATCTTCTCGCCTAATCA[G/T]GACGTCTTTGATGGGTCACGGCCTTTGCTGCAGCAAATGTCTAGTGAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link