mcm6l

Ensembl ID:
ENSDARG00000033231
ZFIN ID:
ZDB-GENE-050913-141
Description:
MCM6 minichromosome maintenance deficient 6, like [Source:RefSeq peptide;Acc:NP_001020704]
Human Orthologue:
MCM6
Human Description:
minichromosome maintenance complex component 6 [Source:HGNC Symbol;Acc:6949]
Mouse Orthologue:
Mcm6
Mouse Description:
minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae) Gene [Source:MGI Sym

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18268 Essential Splice Site Available for shipment Available now
sa2029 Nonsense F2 line generated During 2014
sa10448 Nonsense Available for shipment Available now
sa19897 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000042 Essential Splice Site 116 824 3 17
ENSDART00000147117 None None 238 None 5
Genomic Location:
Chromosome 2 (position 50792832)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCAAAGAGTTTTATGTGGCTTTTTCGGAGTTTCCATCAAGGCAAAAG[T/C]AACYATTTCTGTGCTTAGACACTTTTTGYAGACWCTCTTTAAAACAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2029
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000042 Nonsense 341 824 7 17
ENSDART00000147117 None None 238 None 5
Genomic Location:
Chromosome 2 (position 50787260)
KASP Assay ID:
554-2524.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCWGGAGTGGGAGAAAGTGTTCGAGATGAGCCAAGACAAGAATCTCTA[T/A]CACAACCTCTGCACGAGTCTCTTCCCCACCATTCATGGTGCTCAGCACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000042 Nonsense 558 824 12 17
ENSDART00000147117 None None 238 None 5
Genomic Location:
Chromosome 2 (position 50784054)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTGCCCGGCGTATTGTTGATCTTCATGCCAGGAAYGTTGAATCYGTA[G/T]AAAGAGTTTACAGTACTGATGAAATCCAGCGATACATCTTGTTTGCCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000042 Nonsense 672 824 15 17
ENSDART00000147117 None None 238 None 5
Genomic Location:
Chromosome 2 (position 50780577)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGGTCACACATATTTTAATGTGAAGCAAAAATGTTTGTTCCACAGAT[C/T]AGAATGAGCTGTTTGGTAAGGAGACTGAAGGTCAGAATGGAGGTGATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eldth8n0