prkar2aa

Ensembl ID:
ENSDARG00000033184
ZFIN ID:
ZDB-GENE-030131-1007
Description:
protein kinase, cAMP-dependent, regulatory, type II, alpha A [Source:RefSeq peptide;Acc:NP_00107083
Human Orthologue:
PRKAR2A
Human Description:
protein kinase, cAMP-dependent, regulatory, type II, alpha [Source:HGNC Symbol;Acc:9391]
Mouse Orthologue:
Prkar2a
Mouse Description:
protein kinase, cAMP dependent regulatory, type II alpha Gene [Source:MGI Symbol;Acc:MGI:108025]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34419 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15178 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048676 Essential Splice Site 97 397 3 10
Genomic Location (Zv9):
Chromosome 8 (position 27210650)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26338568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTTGGTGATGGCGGAACTTGTGTAAATAACTGTAACTTCTTTTGATA[G/A]TGTGCGCGGAGGCCTTTAACCCTGATGACGATGAGGAAGATTCTGAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048676 Splice Site, Nonsense 356 397 9 10
Genomic Location (Zv9):
Chromosome 8 (position 27220722)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26348640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATAAACCACGTGCTGCCTCAGCCTATGCTATAGGGGACGWCAAATGCT[T/A]GGGTGAGGAWCTGATTTCATTTATGCACCGAAACTAAATAAAAGCTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link