trappc6bl

Ensembl ID:
ENSDARG00000033171
ZFIN ID:
ZDB-GENE-040426-1602
Description:
trafficking protein particle complex 6b-like [Source:RefSeq peptide;Acc:NP_956955]
Human Orthologue:
TRAPPC6A
Human Description:
trafficking protein particle complex 6A [Source:HGNC Symbol;Acc:23069]
Mouse Orthologue:
Trappc6a
Mouse Description:
trafficking protein particle complex 6A Gene [Source:MGI Symbol;Acc:MGI:1914341]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18603 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043492 Nonsense 83 161 4 7
ENSDART00000133080 Nonsense 83 102 4 5
ENSDART00000147796 None None 77 None 3

The following transcripts of ENSDARG00000033171 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 14113939)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATAATGAAGTTCGTATGTAAAGACTTCTGGAGCACTMTCTTCAAAAAA[C/T]AAATCGACAACTTGAGGACCAACCATCAGGTCTCAATGTTCAGTACTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e80sfia3