psme2

Ensembl ID:
ENSDARG00000033144
ZFIN ID:
ZDB-GENE-991110-16
Description:
proteasome activator complex subunit 2 [Source:RefSeq peptide;Acc:NP_571449]
Human Orthologue:
PSME2
Human Description:
proteasome (prosome, macropain) activator subunit 2 (PA28 beta) [Source:HGNC Symbol;Acc:9569]
Mouse Orthologues:
Psme2, Psme2b-ps
Mouse Descriptions:
protease (prosome, macropain) 28 subunit beta B, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:13
proteasome (prosome, macropain) 28 subunit, beta Gene [Source:MGI Symbol;Acc:MGI:1096365]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31861 Essential Splice Site Available for shipment Available now
sa31862 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049167 Essential Splice Site 49 244 4 11
Genomic Location (Zv9):
Chromosome 12 (position 14426267)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13281920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGCTTGAATTCAGCAACAACTGAATTAAAATATTTCTTTATGATTTT[A/T]GGGCGATGAGTTTAGTATCACTGACCTCTCATCTCTCCATGCACCCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049167 Nonsense 136 244 7 11
Genomic Location (Zv9):
Chromosome 12 (position 14430815)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13286468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTATCCTTTTTTCCTCAGGTTTCTTGCTGGATTGCTCATCTGATTCCC[A/T]AAATTGAAGATGGAAATGACTTTGGAGTTGCAATTCAGGTTATTACATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link