kif7

Ensembl ID:
ENSDARG00000033099
ZFIN ID:
ZDB-GENE-050307-1
Description:
Kinesin-like protein kif7 [Source:UniProtKB/Swiss-Prot;Acc:Q58G59]
Human Orthologue:
KIF7
Human Description:
kinesin family member 7 [Source:HGNC Symbol;Acc:30497]
Mouse Orthologue:
Kif7
Mouse Description:
kinesin family member 7 Gene [Source:MGI Symbol;Acc:MGI:1098239]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8588 Nonsense Mutation detected in F1 DNA During 2016
sa20875 Nonsense Available for shipment Available now
sa38596 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16261 Nonsense Available for shipment Available now
sa34018 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8588
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041577 Nonsense 85 1363 1 18
Genomic Location (Zv9):
Chromosome 7 (position 15319530)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 14196698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGTGTACACTAACTGCGTTCAACCACTTATCGAGGCCTTCTTTCAT[G/T]GATTTAATGCTACYGTGTTTGCCTATGGGCAGACAGGCTCAGGCAAAACY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041577 Nonsense 366 1363 4 18
Genomic Location (Zv9):
Chromosome 7 (position 15308365)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 14185533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGGGCTACAGTCAACTGCCGGGGGGAACCAGATCGCATTGAGGGCCTT[G/T]AACTCCAGATCAAAGCGCTGAGACGAGCCCTTGAAAACCGCCAGCGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041577 Essential Splice Site 595 1363 6 18
Genomic Location (Zv9):
Chromosome 7 (position 15303392)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 14180560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCACTCCTCCCTGCGACTCTGATGTGGGCAGAAGCCTCGCCAGACAG[G/A]TAATTGATATGTTTTGATTTGTCTCACAGCATCCCCGACCGCAAACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041577 Nonsense 774 1363 10 18
Genomic Location (Zv9):
Chromosome 7 (position 15297478)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 14174646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGCTGGAGGCCGAGGCAGAGCAGGCCCGAGTGGAGCTCACAGAGGCA[C/T]AAAAGCAGCTGCAGGAGCTGGAGGTTCAGGGCGGCCGTGATGCCGCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041577 Nonsense 884 1363 12 18
Genomic Location (Zv9):
Chromosome 7 (position 15291210)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 14168378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGTCTCTTTCTCTTTCTCAAAGGAGCTGGAGATAAAGAACGAACAA[C/T]AGCAGAAAATTCTGAGGATTAAGACGGAGGAAATCGCAGCCTTCCAGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link