ptprja

Ensembl ID:
ENSDARG00000033042
ZFIN IDs:
ZDB-GENE-030131-8301, ZDB-GENE-030131-8301
Description:
receptor-type tyrosine-protein phosphatase eta [Source:RefSeq peptide;Acc:NP_001129714]
Human Orthologue:
PTPRJ
Human Description:
protein tyrosine phosphatase, receptor type, J [Source:HGNC Symbol;Acc:9673]
Mouse Orthologue:
Ptprj
Mouse Description:
protein tyrosine phosphatase, receptor type, J Gene [Source:MGI Symbol;Acc:MGI:104574]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6083 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18883 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10152 Essential Splice Site Available for shipment Available now
sa40968 Nonsense Mutation detected in F1 DNA During 2017
sa9428 Nonsense Available for shipment Available now
sa12577 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016087 Essential Splice Site 274 1653 5 29
ENSDART00000047942   None 124 None 7
Genomic Location (Zv9):
Chromosome 7 (position 40981852)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39318109
KASP Assay ID:
554-3934.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTAAACAATCTCAGCAGCTCCTTTATAAACCTCATTGGGTATACAGG[T/G]AMTGCACAGCACAGCATTTAATCTGAGCTGTCGATCGAGTCTTTTTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016087 Essential Splice Site 360 1653 6 29
ENSDART00000047942   None 124 None 7
ENSDART00000016087 Essential Splice Site 360 1653 6 29
ENSDART00000047942   None 124 None 7
Genomic Location (Zv9):
Chromosome 7 (position 40981508)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39317765
KASP Assay ID:
554-6146.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAGCCGGCAACATATCTGGACCCTCACAGTTCATACAGTGTAATACAA[G/A]TGAGTCTACATGCTACACATGTAAATGTAAATGGGTACACTGGCGTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016087 Essential Splice Site 360 1653 6 29
ENSDART00000047942   None 124 None 7
ENSDART00000016087 Essential Splice Site 360 1653 6 29
ENSDART00000047942   None 124 None 7
Genomic Location (Zv9):
Chromosome 7 (position 40981508)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39317765
KASP Assay ID:
554-6146.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAGCCGGCNNNAACATATCTGGACCCTCACARTTCATACAGTGTAATACAA[G/A]TGAGTCTACATGCTACACATGTAAATGTAAATGGKTACACTGGCGTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016087 Nonsense 607 1653 9 29
ENSDART00000047942   None 124 None 7
Genomic Location (Zv9):
Chromosome 7 (position 40971153)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39307410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACATCATCATGTGGACTGTTGGTGCAATGAATTACTCAAGCTCTTCT[A/T]AGAGTCTCACTGCATTTACAAGTAAGCAGTTTGCAATTATTCATGATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016087 Nonsense 768 1653 11 29
ENSDART00000047942   None 124 None 7
Genomic Location (Zv9):
Chromosome 7 (position 40966448)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39302705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCCACTGAAATGATCACTGTGACAAACTTGCAGCCTGGCACAYTGTG[T/A]CAGATCAGTATATATAGTGTGGCATGTGGCCTTCTGGGACAACCAGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016087 Essential Splice Site 967 1653 13 29
ENSDART00000047942   None 124 None 7
Genomic Location (Zv9):
Chromosome 7 (position 40965672)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39301929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCCATTGAATTTGCAGAGTGAATCTATGAGATACAATGTAACTACAAG[T/A]AAGTTWACAAWTATAATTATAGTKTATAATTRTATTGTGCTGTATTTTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link