ENSDARG00000033029

Ensembl ID:
ENSDARG00000033029
Human Orthologue:
PKD1
Human Description:
polycystic kidney disease 1 (autosomal dominant) [Source:HGNC Symbol;Acc:9008]
Mouse Orthologue:
Pkd1
Mouse Description:
polycystic kidney disease 1 homolog Gene [Source:MGI Symbol;Acc:MGI:97603]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17876 Nonsense Available for shipment Available now
sa17144 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045361 Nonsense 691 1253 19 28
Genomic Location:
Chromosome 12 (position 23091239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGTTTAGTGWAYATGCTYTTCCTGTTGGTGGTYCTGATGGTGAACTA[T/A]CAGGAACATRTGCAGATGGCTGACARTAGACGGCTTCAMTCCGCCATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045361 Nonsense 926 1253 25 28
Genomic Location:
Chromosome 12 (position 23096182)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTATTCGCCCTGTRCTTTYTGAGTAYTGAAGTGCGAGCCTTGATCAGR[A/T]AGCCAAGTCAATACCTGAGGCAGGCCTGGTGCTGGTTTCAGACACTGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f16ru5nh