ENSDARG00000033029

Ensembl ID:
ENSDARG00000033029
Human Orthologue:
PKD1
Human Description:
polycystic kidney disease 1 (autosomal dominant) [Source:HGNC Symbol;Acc:9008]
Mouse Orthologue:
Pkd1
Mouse Description:
polycystic kidney disease 1 homolog Gene [Source:MGI Symbol;Acc:MGI:97603]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17876 Nonsense Available for shipment Available now
sa17144 Nonsense Available for shipment Available now
sa27948 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa17876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045361 Nonsense 691 1253 19 28
Genomic Location:
Chromosome 12 (position 23091239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGTTTAGTGWAYATGCTYTTCCTGTTGGTGGTYCTGATGGTGAACTA[T/A]CAGGAACATRTGCAGATGGCTGACARTAGACGGCTTCAMTCCGCCATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045361 Nonsense 926 1253 25 28
Genomic Location:
Chromosome 12 (position 23096182)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTATTCGCCCTGTRCTTTYTGAGTAYTGAAGTGCGAGCCTTGATCAGR[A/T]AGCCAAGTCAATACCTGAGGCAGGCCTGGTGCTGGTTTCAGACACTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045361 Nonsense 994 1253 25 28
Genomic Location:
Chromosome 12 (position 23096387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATAGCGCTGCCACAGTGGCCAGAAAGTCCAATCAGCTCTCAGCAATAT[T/A]ATTAACCCTCTTGGCTCTAAAGGTATATTATTCTAAAGCAAAAAATGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f16ru5nh