plxnb3

Ensembl ID:
ENSDARG00000032990
ZFIN ID:
ZDB-GENE-081104-53
Description:
Novel protein similar to vertebrate plexin B family [Source:UniProtKB/TrEMBL;Acc:B0V3R5]
Human Orthologue:
PLXNB3
Human Description:
plexin B3 [Source:HGNC Symbol;Acc:9105]
Mouse Orthologue:
Plxnb3
Mouse Description:
plexin B3 Gene [Source:MGI Symbol;Acc:MGI:2154240]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34299 Nonsense Mutation detected in F1 DNA During 2017
sa21199 Nonsense Available for shipment Available now
sa13997 Essential Splice Site Available for shipment Available now
sa10506 Nonsense Available for shipment Available now
sa11827 Essential Splice Site Available for shipment Available now
sa18565 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026965 Nonsense 197 2058 1 40
ENSDART00000144838   None 1095 None 23

The following transcripts of ENSDARG00000032990 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8741508)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8158090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGGGGCTACACCAGTAAAGGACCTGGTGGGATCCCACCAATCACAATG[C/T]GACGTTTAACCCCAGTTGAGCGACATTCTGCACCGGCGTTCTCCCATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21199
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026965 Nonsense 308 2058 1 40
ENSDART00000144838   None 1095 None 23

The following transcripts of ENSDARG00000032990 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8741841)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8158423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCTTTCACCGGGAGCAACCTGCGCTGTTTGTGGCTATGGCCATGGGA[C/T]AAGCATCAACTCCTACACCCACAGACAAGTCGGCTCTTTGTGTGTACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026965 Essential Splice Site 471 2058 3 40
ENSDART00000144838   None 1095 None 23

The following transcripts of ENSDARG00000032990 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8760486)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8177068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGCTGGAYGCCACCAAACAGAACRTCTTCGTATTGACYGAAAGAAAG[G/A]TAYTGGAGACAAACTGCTTCCTTTTATCTGSCRTCAAGTGAAACAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026965 Nonsense 1119 2058 19 40
ENSDART00000144838 Nonsense 161 1095 3 23

The following transcripts of ENSDARG00000032990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8789184)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8205766
KASP Assay ID:
2260-0147.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCTGAGCAGGATTGTCCCAGAAAAAGGSCCCTTGGCYGGAGRTACGT[T/A]GCTCATGGTGTATGGGTCACAGCTCCTGACAGGACAAAACCTTCAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026965 Essential Splice Site 1391 2058 24 40
ENSDART00000144838 Essential Splice Site 428 1095 7 23

The following transcripts of ENSDARG00000032990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8798334)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8214916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KGATGTCCAGCCTCTCGCTCTGGACGACAGTAACTTACCCACACTAAAGG[T/G]CAGTCTACGTTCAGTGYCGTCCTTGGKTGTTTCATTGTGTGTTTTTTWAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026965 Nonsense 1534 2058 27 40
ENSDART00000144838 Nonsense 571 1095 10 23

The following transcripts of ENSDARG00000032990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 8802163)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8218745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCYGGATTTACCCGACTCTCGCAGGCAGACAGTGGAGCAGGGCCTTTCK[C/T]AGCTCAAMAACCTGCTCAACAACAGACTCTTCCTCATACGGGTCAGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link