her12

Ensembl ID:
ENSDARG00000032963
ZFIN ID:
ZDB-GENE-040824-5
Description:
hairy-related 12 [Source:RefSeq peptide;Acc:NP_991182]
Human Orthologue:
HES5
Human Description:
hairy and enhancer of split 5 (Drosophila) [Source:HGNC Symbol;Acc:19764]
Mouse Orthologue:
Hes5
Mouse Description:
hairy and enhancer of split 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104876]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24312 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24312
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044080 Nonsense 155 155 2 2
ENSDART00000112929 Nonsense 155 155 2 3
Genomic Location (Zv9):
Chromosome 23 (position 21739601)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21518908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGCTGCTTTACAGCACCCAGACAGCGTGAGGGCCGTCTGGAGACCCT[G/A]GTAGAGATCCTGTGGACTGACAACCCTGAGGGACGGTGGTATTAACATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link