nrbp2

Ensembl ID:
ENSDARG00000032951
ZFIN ID:
ZDB-GENE-070713-4
Description:
Novel protein similar to vertebrate nuclear receptor binding protein 2 (NRBP2) [Source:UniProtKB/TrE
Human Orthologue:
NRBP2
Human Description:
nuclear receptor binding protein 2 [Source:HGNC Symbol;Acc:19339]
Mouse Orthologue:
Nrbp2
Mouse Description:
nuclear receptor binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2385017]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32953 Nonsense Mutation detected in F1 DNA During 2017
sa11607 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041146 Nonsense 212 508 8 18
ENSDART00000098854   None 230 None 8
ENSDART00000135293 Nonsense 204 500 7 17

The following transcripts of ENSDARG00000032951 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 32401685)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32700592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTCCTTCAGTATTTGCTGAGGCGATTCATGGGAATGTGCATCAGCAT[C/T]GAGATGAAGTGCGGAACCAGCATTTCTTTGCACCAGAGTATGGCAGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041146 Nonsense 426 508 15 18
ENSDART00000098854 Nonsense 198 230 7 8
ENSDART00000135293 Nonsense 418 500 14 17

The following transcripts of ENSDARG00000032951 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 32397826)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32696733
KASP Assay ID:
2259-2235.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTAAAATCCTTGTTTTTTCGCATAGGTTGTCCAGATCCACTGTAATT[T/A]GGAAGCAACTGARGAAGGCACAAGGAGTCATGTAAGTCTCATTTGTAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link