cnksr1

Ensembl ID:
ENSDARG00000032932
ZFIN ID:
ZDB-GENE-040426-1802
Description:
connector enhancer of kinase suppressor of ras 1 [Source:RefSeq peptide;Acc:NP_991222]
Human Orthologue:
CNKSR1
Human Description:
connector enhancer of kinase suppressor of Ras 1 [Source:HGNC Symbol;Acc:19700]
Mouse Orthologue:
Cnksr1
Mouse Description:
connector enhancer of kinase suppressor of Ras 1 Gene [Source:MGI Symbol;Acc:MGI:2670958]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6479 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050018 Essential Splice Site 180 780 5 21
Genomic Location:
Chromosome 17 (position 26865504)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTAGGAAACCGCTGTGTTTGAAAAGGAGAAGGAMATCATATCCATAG[T/A]AAGTTCACTCTTACTTTTTTCATGACTCTTGATTCTTTGATTTAATACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qy0f11v9