cryba1l

Ensembl ID:
ENSDARG00000032929
ZFIN ID:
ZDB-GENE-050417-249
Description:
crystallin, beta A1, like [Source:RefSeq peptide;Acc:NP_001017738]
Human Orthologues:
CRYBA1, CRYBA4
Human Descriptions:
crystallin, beta A1 [Source:HGNC Symbol;Acc:2394]
crystallin, beta A4 [Source:HGNC Symbol;Acc:2396]
Mouse Orthologues:
Cryba1, Cryba4
Mouse Descriptions:
crystallin, beta A1 Gene [Source:MGI Symbol;Acc:MGI:88518]
crystallin, beta A4 Gene [Source:MGI Symbol;Acc:MGI:102716]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16876 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047525 Nonsense 78 208 4 6
Genomic Location:
Chromosome 14 (position 49250582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTTTTTGCAGCTGGGTGGGTTACGAGCACCACGACTTCCAGGGCCAG[C/T]AGTTCATCCTGGAGAGAGGAGAGTATCCTCACTGGGACGCCTACAGCGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i79lw1uv