chchd3

Ensembl ID:
ENSDARG00000032919
ZFIN ID:
ZDB-GENE-030131-5005
Description:
coiled-coil-helix-coiled-coil-helix domain-containing protein 3, mitochondrial [Source:RefSeq pepti
Human Orthologue:
CHCHD3
Human Description:
coiled-coil-helix-coiled-coil-helix domain containing 3 [Source:HGNC Symbol;Acc:21906]
Mouse Orthologue:
Chchd3
Mouse Description:
coiled-coil-helix-coiled-coil-helix domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1913325]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20243 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041420 Essential Splice Site 27 316 None 11
ENSDART00000101634 Essential Splice Site 27 317 None 9
ENSDART00000122520 Essential Splice Site 27 317 None 9
ENSDART00000143317 Essential Splice Site 27 161 None 2
Genomic Location:
Chromosome 4 (position 14668740)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGAGTCGGATGAGAATGACAACATAACGATAGTGAAGGGCATCAGGG[T/G]GAGTGACACACACGTCTGTTCTCCTCCACCTGTCAAACGCACATCAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kvd6z6v4