si:ch211-194e15.1

Ensembl ID:
ENSDARG00000032876
ZFIN ID:
ZDB-GENE-060503-297
Description:
tRNA dimethylallyltransferase, mitochondrial [Source:RefSeq peptide;Acc:NP_001038239]
Human Orthologue:
TRIT1
Human Description:
tRNA isopentenyltransferase 1 [Source:HGNC Symbol;Acc:20286]
Mouse Orthologue:
Trit1
Mouse Description:
tRNA isopentenyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1914216]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36863 Nonsense Mutation detected in F1 DNA During 2017
sa14214 Nonsense Available for shipment Available now
sa23552 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045504 Nonsense 373 455 9 11
ENSDART00000125893   None 330 None 9
ENSDART00000128560 Nonsense 365 447 9 11

The following transcripts of ENSDARG00000032876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31969583)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31136872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGGGAGACTACTGTACTTACTCCTGCTCTAGAGATCCTGGACTGCCTC[C/T]AAAAGGTTTGACTTGTTTCCATTTACTTTTAATGTCTTCCTTACACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14214
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045504 Nonsense 410 455 10 11
ENSDART00000125893   None 330 None 9
ENSDART00000128560 Nonsense 402 447 10 11

The following transcripts of ENSDARG00000032876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31969266)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31136555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGAGTCATCACATGTGCGATCTGTGCGAAAAGGTAATCATTGGAGACT[T/A]GGAATGGACRGGTGAGTTTTTAATYTAGTAAAACYAGTGCGTTCTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045504 Nonsense 423 455 11 11
ENSDART00000125893   None 330 None 9
ENSDART00000128560 Nonsense 415 447 11 11

The following transcripts of ENSDARG00000032876 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 31969136)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31136425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCACCTGTCTTGACTTTTAGCTCACCAGAAGTCCAAAAACCATCTTTA[T/G]CAAGTCCGTAAGAAGAGGAAATCAGAGCAGGCCACAGATCTGGATACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link